Other
Part:BBa_I716332:Design
Designed by: nhu nguyen Group: iGEM07_Berkeley_UC (2007-07-11)
ThpB
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 29
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 29
Illegal NotI site found at 343
Illegal NotI site found at 786 - 21INCOMPATIBLE WITH RFC[21]Illegal prefix found in sequence at 29
Illegal XhoI site found at 1070 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 29
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 29
Illegal NgoMIV site found at 197
Illegal NgoMIV site found at 821
Illegal AgeI site found at 963 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 77
Illegal BsaI.rc site found at 668
Design Notes
This part is built in Biobrick version 2.0. In this format, parts are flanked by BglII and BamHI restriction sites.
Source
ThpB
From IGEM07
PCR ThpBF/ ThpBIR on ThpB (610 bp, gp=A)
PCR ThpBR/ ThpBIF on ThpB (712 bp, gp=B)
PCR ThpBAF/ThpBAR on A+B (1285bp BglII/XhoI)
Digest pBca9145-Bca1144 (BglII/XhoI 2054+910, L)
Product pBca9145-BBa I716332
ThpBF Forward BglII site anneals to ThpB ctagaAGATCTgtgaccatcaccccgcccgc
ThpBIF Removing XhoI site in ThpB ggttcgagcggctcctTgaggaccagggctccggac
ThpBIR Removing XhoI site in ThpD gtccggagccctggtcctcAaggagccgctcgaacc
ThpBR Reverse XhoI site anneals to ThpB cgtcactcgagtcaggccgtttcgcggacgc